pGI3EM29
(Plasmid
#135489)
-
PurposeAgrobacterium T-DNA with Spun H2Bpr driving hph-mCitrine
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGI3EM18
- Backbone size w/o insert (bp) 10906
- Total vector size (bp) 11629
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUsed in Agrobacterium EHA105 for transformation
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehph SpunH2A/Bpr hph-mCitrine
-
SpeciesS. cerevisiae (budding yeast); Spizellomyces punctatus
- Promoter SpunH2A/Bpr (divergent)
-
Tag
/ Fusion Protein
- mCitrine (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cttgtatggagcagcagacg
- 3′ sequencing primer caggaaacagctatgac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mCitrine was obtained by PCR of mCitrine-PCNA-19-SV40NLS-4 (Addgene plasmid # 56564), a plasmid created by the Davidson lab
The pGI3 vector was a gift from Giuseppe Ianiri
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGI3EM29 was a gift from Nicolas Buchler (Addgene plasmid # 135489 ; http://n2t.net/addgene:135489 ; RRID:Addgene_135489) -
For your References section:
Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127