Skip to main content
Addgene

pGI3EM30
(Plasmid #135490)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135490 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGI3EM18
  • Backbone size w/o insert (bp) 10906
  • Total vector size (bp) 11629
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Used in Agrobacterium EHA105 for transformation
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hph SpunH2A/Bpr hph-mClover3
  • Species
    S. cerevisiae (budding yeast); Spizellomyces punctatus
  • Promoter SpunH2A/Bpr (divergent)
  • Tag / Fusion Protein
    • mClover3 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cttgtatggagcagcagacg
  • 3′ sequencing primer caggaaacagctatgac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mClover3 was obtained by PCR of pKK-mClover3-TEV (Addgene plasmid \# 105778), a plasmid created by the Dziembowski lab

The pGI3 vector was a gift from Giuseppe Ianiri

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGI3EM30 was a gift from Nicolas Buchler (Addgene plasmid # 135490 ; http://n2t.net/addgene:135490 ; RRID:Addgene_135490)
  • For your References section:

    Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127