Skip to main content

pCAG_Xph15-eGFP-CCR5TC
(Plasmid #135528)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135528 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Backbone manufacturer
    Don B. Arnold lab (USC)
  • Backbone size w/o insert (bp) 7120
  • Total vector size (bp) 7492
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Xph15
  • Species
    Synthetic
  • Insert Size (bp)
    322
  • Promoter CAG
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer pCAG-F
  • 3′ sequencing primer GGTTCTGATGTGCCTGCTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.04.07.438431 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG_Xph15-eGFP-CCR5TC was a gift from Matthieu Sainlos (Addgene plasmid # 135528 ; http://n2t.net/addgene:135528 ; RRID:Addgene_135528)
  • For your References section:

    Engineering paralog-specific PSD-95 recombinant binders as minimally interfering multimodal probes for advanced imaging techniques. Rimbault C, Breillat C, Compans B, Toulme E, Nunes Vicente F, Fernandez-Monreal M, Mascalchi P, Genuer C, Puente-Munoz V, Gauthereau I, Hosy E, Claverol S, Giannone G, Chamma I, Mackereth CD, Poujol C, Choquet D, Sainlos M. Elife. 2024 Jan 3;13:e69620. doi: 10.7554/eLife.69620. 10.7554/eLife.69620 PubMed 38167295