-
PurposeEncodes a specific PSD-95 binder (Xph20) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
-
Backbone manufacturerDon B. Arnold lab (USC)
- Backbone size w/o insert (bp) 7120
- Total vector size (bp) 7498
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameXph20
-
SpeciesSynthetic
-
Insert Size (bp)328
- Promoter CAG
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer GGTTCTGATGTGCCTGCTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.04.07.438431 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG_Xph20-eGFP-CCR5TC was a gift from Matthieu Sainlos (Addgene plasmid # 135530 ; http://n2t.net/addgene:135530 ; RRID:Addgene_135530) -
For your References section:
Engineering paralog-specific PSD-95 recombinant binders as minimally interfering multimodal probes for advanced imaging techniques. Rimbault C, Breillat C, Compans B, Toulme E, Nunes Vicente F, Fernandez-Monreal M, Mascalchi P, Genuer C, Puente-Munoz V, Gauthereau I, Hosy E, Claverol S, Giannone G, Chamma I, Mackereth CD, Poujol C, Choquet D, Sainlos M. Elife. 2024 Jan 3;13:e69620. doi: 10.7554/eLife.69620. 10.7554/eLife.69620 PubMed 38167295