Skip to main content

pFastBac HT JS-Rab10wt
(Plasmid #135557)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135557 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rab10
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    603
  • Entrez Gene
    Rab10 (a.k.a. AW107754)
  • Promoter polyhedrin promoter
  • Tag / Fusion Protein
    • 6xHis tag, TEV site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer polyhedrin promoter
  • 3′ sequencing primer TAAGCTGCAATAAACAAGTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac HT JS-Rab10wt was a gift from Jingshi Shen (Addgene plasmid # 135557 ; http://n2t.net/addgene:135557 ; RRID:Addgene_135557)
  • For your References section:

    RABIF/MSS4 is a Rab-stabilizing holdase chaperone required for GLUT4 exocytosis. Gulbranson DR, Davis EM, Demmitt BA, Ouyang Y, Ye Y, Yu H, Shen J. Proc Natl Acad Sci U S A. 2017 Sep 26;114(39):E8224-E8233. doi: 10.1073/pnas.1712176114. Epub 2017 Sep 11. 10.1073/pnas.1712176114 PubMed 28894007