Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLGB36
(Plasmid #135621)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135621 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLGB13
  • Backbone size w/o insert (bp) 4093
  • Total vector size (bp) 5040
  • Modifications to backbone
    ss-bfe1 removed and replaced with ss-bfe3
  • Vector type
    Bacteroides suicide vector with inducible counter-selection toxin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    S17 lambda pir
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    bfe3
  • Alt name
    M136_1999
  • Species
    Bacteroides fragilis
  • Insert Size (bp)
    885
  • GenBank ID
    EXZ28783.1
  • Promoter Bacteroides promoter regualted by TetR transcriptional regulator
  • Tag / Fusion Protein
    • signal sequence for periplasmic targeting (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acatataaaagaaaagacacatgaagaaaattttatctttgc
  • 3′ sequencing primer ctgcagcccgggggatccactcatctgatactatgccaatg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLGB36 was a gift from Laurie Comstock (Addgene plasmid # 135621 ; http://n2t.net/addgene:135621 ; RRID:Addgene_135621)
  • For your References section:

    Genetic and Biochemical Analysis of Anaerobic Respiration in Bacteroides fragilis and Its Importance In Vivo. Ito T, Gallegos R, Matano LM, Butler NL, Hantman N, Kaili M, Coyne MJ, Comstock LE, Malamy MH, Barquera B. mBio. 2020 Feb 4;11(1). pii: mBio.03238-19. doi: 10.1128/mBio.03238-19. 10.1128/mBio.03238-19 PubMed 32019804