pLGB36
(Plasmid #135621)

• Purpose: Suicide vector for allelic replacement in Bacteroides species including B. fragilis strain 638R, erythromycin selection and aTC-inducible ss-Bfe3 counterselection
• Depositing Lab: Laurie Comstock
• Publication: Ito et al mBio. 2020 Feb 4;11(1). pii: mBio.03238-19. doi: 10.1128/mBio.03238-19.

Backbone

• Vector backbone: pLGB13
• Backbone size w/o insert (bp): 4093
• Total vector size (bp): 5040
• Modifications to backbone: ss-bfe1 removed and replaced with ss-bfe3
• Vector type: Bacteroides suicide vector with inducible counter-selection toxin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): S17 lambda pir
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: bfe3
• Alt name: M136_1999
• Species: Bacteroides fragilis
• Insert Size (bp): 885
• GenBank ID: EXZ28783.1
• Promoter: Bacteroides promoter regualted by TetR transcriptional regulator
• Tag / Fusion Protein:
  • signal sequence for periplasmic targeting (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acatataaaagaaaagacacatgaagaaaattttatctttgc
• 3′ sequencing primer: ctgcagcccgggggatccactcatctgatactatgccaatg

Resource Information

• Supplemental Documents:
  • pLGB36.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry