Skip to main content

pQlox71R
(Plasmid #135656)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135656 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAT19
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 10208
  • Vector type
    Bacterial Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intron containing lox site
  • Species
    Synthetic
  • Insert Size (bp)
    3507
  • GenBank ID
  • Promoter pFer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PaeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
  • 3′ sequencing primer TACATCACCGACGAGCAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Intron from pQint (addgene 25819)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use in combination with pQlox66F (addgene 135657) or pQlox 66R (addgene 135658), then pQcre1 (addgene 135659).

Transcription of LtrB-derived group II intron is driven by the pFer promoter. Redesign intron to target gene using TargeTron or Clostron algorithms (links below), then clone by SOE-PCR or gene synthesis ligation between NdeI and BsrGI sites.

Lox66 and Lox71 must be in same orientation to delete the intervening sequence, but the directions of introns relative to one another can generate inverted repeats in the chromosome after deletion has taken place, leading to futher recombinations events. See publication for details.

Intron redesign links

http://www.clostron.com/clostron1.php
http://www.targetrons.com/targetron_pLtrB.php

Reference for intron redesign

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. The ClosTron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods. 2007;70(3):452-464.

Perutka J, Wang W, Goerlitz D, Lambowitz AM. Use of Computer-designed Group II Introns to Disrupt Escherichia coli DExH / D-box Protein and DNA Helicase Genes. 2004:421-439.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQlox71R was a gift from Andrew Tolonen (Addgene plasmid # 135656 ; http://n2t.net/addgene:135656 ; RRID:Addgene_135656)
  • For your References section:

    A Targetron-Recombinase System for Large-Scale Genome Engineering of Clostridia. Cerisy T, Rostain W, Chhun A, Boutard M, Salanoubat M, Tolonen AC. mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19. 10.1128/mSphere.00710-19 PubMed 31826971