Skip to main content

pQcre1
(Plasmid #135659)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135659 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAT19
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7752
  • Vector type
    Bacterial Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Alt name
    Cre
  • Species
    P1 phage
  • Insert Size (bp)
    1032
  • GenBank ID
    YP_006472.1
  • Promoter ppag promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
  • 3′ sequencing primer TACATCACCGACGAGCAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cre expression cassette cloned from pRAB1 provided by Dr. Ralph Bertram and Christopher F. Schuster

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cre protein under the control of the gram + PpagA promoter.

Leibig M, Krismer B, Kolb M, Friede A, Götz F, Bertram R. 2008. Marker removal in staphylococci via Cre recombinase and different lox sites. Appl Environ Microbiol 74:1316– 1323.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQcre1 was a gift from Andrew Tolonen (Addgene plasmid # 135659 ; http://n2t.net/addgene:135659 ; RRID:Addgene_135659)
  • For your References section:

    A Targetron-Recombinase System for Large-Scale Genome Engineering of Clostridia. Cerisy T, Rostain W, Chhun A, Boutard M, Salanoubat M, Tolonen AC. mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19. 10.1128/mSphere.00710-19 PubMed 31826971