pQcre1
(Plasmid
#135659)
-
PurposeClostridial vector, encoding the Cre protein, which mediates recombination between lox sites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAT19
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 7752
-
Vector typeBacterial Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
SpeciesP1 phage
-
Insert Size (bp)1032
-
GenBank IDYP_006472.1
- Promoter ppag promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer TACATCACCGACGAGCAAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCre expression cassette cloned from pRAB1 provided by Dr. Ralph Bertram and Christopher F. Schuster
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cre protein under the control of the gram + PpagA promoter.
Leibig M, Krismer B, Kolb M, Friede A, Götz F, Bertram R. 2008. Marker removal in staphylococci via Cre recombinase and different lox sites. Appl Environ Microbiol 74:1316– 1323.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQcre1 was a gift from Andrew Tolonen (Addgene plasmid # 135659 ; http://n2t.net/addgene:135659 ; RRID:Addgene_135659) -
For your References section:
A Targetron-Recombinase System for Large-Scale Genome Engineering of Clostridia. Cerisy T, Rostain W, Chhun A, Boutard M, Salanoubat M, Tolonen AC. mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19. 10.1128/mSphere.00710-19 PubMed 31826971