Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQcre1
(Plasmid #135659)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135659 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAT19
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7752
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    200 µg/mL erythromycin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Alt name
    Cre
  • Species
    P1 phage
  • Insert Size (bp)
    1032
  • GenBank ID
    YP_006472.1
  • Promoter ppag promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
  • 3′ sequencing primer TACATCACCGACGAGCAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cre expression cassette cloned from pRAB1 provided by Dr. Ralph Bertram and Christopher F. Schuster

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cre protein under the control of the gram + PpagA promoter.

Leibig M, Krismer B, Kolb M, Friede A, Götz F, Bertram R. 2008. Marker removal in staphylococci via Cre recombinase and different lox sites. Appl Environ Microbiol 74:1316– 1323.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQcre1 was a gift from Andrew Tolonen (Addgene plasmid # 135659 ; http://n2t.net/addgene:135659 ; RRID:Addgene_135659)
  • For your References section:

    A Targetron-Recombinase System for Large-Scale Genome Engineering of Clostridia. Cerisy T, Rostain W, Chhun A, Boutard M, Salanoubat M, Tolonen AC. mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19. 10.1128/mSphere.00710-19 PubMed 31826971