pQadd1R
(Plasmid
#135661)
-
PurposeClostridial vector, encoding a targetron carrying two lox511/71 and loxFAS/66 sites in tandem, in the reverse (antisense) orientation. Retarget intron to insert double-lox site at desired location.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135661 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAT19
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 10268
-
Vector typeBacterial Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntron containing lox site
-
SpeciesSynthetic
-
Insert Size (bp)3567
-
GenBank ID
- Promoter pFer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PaeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer TACATCACCGACGAGCAAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIntron from pQint (addgene 25819)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transcription of LtrB-derived group II intron is driven by the pFer promoter. Redesign intron to target gene using TargeTron or Clostron algorithms (links below), then clone by SOE-PCR or gene synthesis ligation between NdeI and BsrGI sites.
Intron redesign links
http://www.clostron.com/clostron1.php
http://www.targetrons.com/targetron_pLtrB.php
Reference for intron redesign
Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. The ClosTron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods. 2007;70(3):452-464.
Perutka J, Wang W, Goerlitz D, Lambowitz AM. Use of Computer-designed Group II Introns to Disrupt Escherichia coli DExH / D-box Protein and DNA Helicase Genes. 2004:421-439.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQadd1R was a gift from Andrew Tolonen (Addgene plasmid # 135661 ; http://n2t.net/addgene:135661 ; RRID:Addgene_135661) -
For your References section:
A Targetron-Recombinase System for Large-Scale Genome Engineering of Clostridia. Cerisy T, Rostain W, Chhun A, Boutard M, Salanoubat M, Tolonen AC. mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19. 10.1128/mSphere.00710-19 PubMed 31826971