Tol2-pA-GI-TagRFP-E1b-5xUAS-E1b-eGFP-GI-pA-Tol2; gcryst:CFP
(Plasmid
#135812)
-
PurposeThis plasmid can be used to express independently eGFP and TagRFP from a bidirectional 5xUAS. Also CFP expression under crystallin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDestTol2pA2AC
-
Vector typezebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTagRFP
-
Alt nameTagRFP
-
SpeciesSynthetic
-
Insert Size (bp)735
-
GenBank IDZDB-EFG-110425-1
- Promoter UAS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGAGCTCCTCCACACGAATTGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-pA-GI-TagRFP-E1b-5xUAS-E1b-eGFP-GI-pA-Tol2; gcryst:CFP was a gift from Nadia Mercader Huber (Addgene plasmid # 135812 ; http://n2t.net/addgene:135812 ; RRID:Addgene_135812) -
For your References section:
Wilms Tumor 1b Expression Defines a Pro-regenerative Macrophage Subtype and Is Required for Organ Regeneration in the Zebrafish. Sanz-Morejon A, Garcia-Redondo AB, Reuter H, Marques IJ, Bates T, Galardi-Castilla M, Grosse A, Manig S, Langa X, Ernst A, Piragyte I, Botos MA, Gonzalez-Rosa JM, Ruiz-Ortega M, Briones AM, Salaices M, Englert C, Mercader N. Cell Rep. 2019 Jul 30;28(5):1296-1306.e6. doi: 10.1016/j.celrep.2019.06.091. 10.1016/j.celrep.2019.06.091 PubMed 31365871