Skip to main content

pWXLd-RIEP-OgNLuc
(Plasmid #135936)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135936 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWPXLd
  • Backbone size w/o insert (bp) 10455
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OgNLuc LumiFluor
  • Alt name
    OgNLuc
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWXLd-RIEP-OgNLuc was a gift from Antonio Amelio (Addgene plasmid # 135936 ; http://n2t.net/addgene:135936 ; RRID:Addgene_135936)
  • For your References section:

    Engineered BRET-Based Biologic Light Sources Enable Spatio-Temporal Control Over Diverse Optogenetic Systems. Parag-Sharma K, O'Banion CP, Henry EC, Musicant AM, Cleveland JL, Lawrence DS, Amelio AL. ACS Synth Biol. 2019 Dec 13. doi: 10.1021/acssynbio.9b00277. 10.1021/acssynbio.9b00277 PubMed 31834783