1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
(Plasmid
#135979)
-
PurposegRNA against the left loxP site of the Ai9 allele
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEMBL8
- Backbone size w/o insert (bp) 2416
- Total vector size (bp) 7164
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAi9 gRNA1
-
gRNA/shRNA sequenceGCTCTAGAGTCGCAGATCCTC
-
SpeciesStaphylococcus aureus
- Promoter U6
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C was a gift from William Lagor (Addgene plasmid # 135979 ; http://n2t.net/addgene:135979 ; RRID:Addgene_135979)