pcDNA3.3-3XFLAG-AGO2
(Plasmid
#136687)
-
PurposeExpresses human AGO2 with an N-terminal 3XFLAG tag in mammalian cells (using a CMV promoter)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameargonaute RISC Catalytic Component 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2658
-
GenBank ID27161 NM_012154.5
-
Entrez GeneAGO2 (a.k.a. CASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10)
-
Tag
/ Fusion Protein
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATAATACCGCGCCACATAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/414763 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.3-3XFLAG-AGO2 was a gift from David Bartel (Addgene plasmid # 136687 ; http://n2t.net/addgene:136687 ; RRID:Addgene_136687) -
For your References section:
The biochemical basis of microRNA targeting efficacy. McGeary SE, Lin KS, Shi CY, Pham TM, Bisaria N, Kelley GM, Bartel DP. Science. 2019 Dec 20;366(6472). pii: science.aav1741. doi: 10.1126/science.aav1741. Epub 2019 Dec 5. 10.1126/science.aav1741 PubMed 31806698