Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-hSyn-DFO-ChR2(H134R)-EYFP-WPRE
(Plasmid #136916)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4843
  • Total vector size (bp) 6510
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChR2(H134R)-EYFP
  • Alt name
    ChR2
  • Species
    Synthetic
  • Insert Size (bp)
    1667
  • Mutation
    H134R in ChR2
  • GenBank ID
    AF461397.1
  • Promoter Human Synapsin1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer accgccgcctcagcactgaa
  • 3′ sequencing primer agccatacgggaagcaatagca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DFO-ChR2(H134R)-EYFP-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 136916 ; http://n2t.net/addgene:136916 ; RRID:Addgene_136916)
  • For your References section:

    Pathway-, layer- and cell-type-specific thalamic input to mouse barrel cortex. Sermet BS, Truschow P, Feyerabend M, Mayrhofer JM, Oram TB, Yizhar O, Staiger JF, Petersen CC. Elife. 2019 Dec 20;8. pii: 52665. doi: 10.7554/eLife.52665. 10.7554/eLife.52665 PubMed 31860443