Flag-2xAPEX2-C Cloning Vector
(Plasmid
#136991)
-
Purpose(Empty Backbone) To express a protein of interest fused to the C-terminus of Flag-2xAPEX2 for proximity labeling or TEM
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPEX2
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (pCD-betaG-FLAG-R)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector contains 2 copies of the APEX2 gene for increased activity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-2xAPEX2-C Cloning Vector was a gift from Ken-Ichi Takemaru (Addgene plasmid # 136991 ; http://n2t.net/addgene:136991 ; RRID:Addgene_136991)