Skip to main content

pLRC1-NEK10p:NEK10-3XFLAG
(Plasmid #137030)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137030 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLRC1
  • Backbone size w/o insert (bp) 8454
  • Total vector size (bp) 11843
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NIMA-like kinase 10
  • Alt name
    NEK10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3389
  • Entrez Gene
    NEK10 (a.k.a. FLJ32685)
  • Promoter human NEK10 endogenous promoter
  • Tag / Fusion Protein
    • 3XFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcccgaaggaatagaagaa
  • 3′ sequencing primer actgccatttgtctcgaggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLRC1-NEK10p:NEK10-3XFLAG was a gift from David Sabatini (Addgene plasmid # 137030 ; http://n2t.net/addgene:137030 ; RRID:Addgene_137030)
  • For your References section:

    A human ciliopathy reveals essential functions for NEK10 in airway mucociliary clearance. Chivukula RR, Montoro DT, Leung HM, Yang J, Shamseldin HE, Taylor MS, Dougherty GW, Zariwala MA, Carson J, Daniels MLA, Sears PR, Black KE, Hariri LP, Almogarri I, Frenkel EM, Vinarsky V, Omran H, Knowles MR, Tearney GJ, Alkuraya FS, Sabatini DM. Nat Med. 2020 Jan 20. pii: 10.1038/s41591-019-0730-x. doi: 10.1038/s41591-019-0730-x. 10.1038/s41591-019-0730-x PubMed 31959991