pP13-TEV-His12
(Plasmid
#137035)
-
Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi P13 with C-terminal TEV-protease-cleavable His12
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSET-TEV-12His
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAC66426.1
-
Alt nameP13 BB0034
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild type, full-length protein, contains signal peptide
-
Entrez GeneBB_0034 (a.k.a. BB_0034)
- Promoter T7
-
Tag
/ Fusion Protein
- His12 (TEV protease cleavable) (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid uses the T7 promoter to express in E. coli the full-length, wild-type protein containing a C-terminal TEV-protease-cleavable His12-tag. The protein sequence includes its N-terminal membrane-targeting signal peptide sequence. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pP13-TEV-His12 was a gift from Debra Hansen (Addgene plasmid # 137035 ; http://n2t.net/addgene:137035 ; RRID:Addgene_137035) -
For your References section:
Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280