Skip to main content

pOZ-C 16 E7
(Plasmid #13705)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13705 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOZ-C
  • Backbone size w/o insert (bp) 8000
  • Vector type
    Mammalian Expression
  • Selectable markers
    IL-2 receptor

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HPV 16 E7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    300
  • GenBank ID
    AY089955
  • Entrez Gene
    E7 (a.k.a. HpV16gp2)
  • Tags / Fusion Proteins
    • FLAG (C terminal on backbone)
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACGTGAAGGCTGCCGACCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOZ-C 16 E7 was a gift from Karl Munger (Addgene plasmid # 13705 ; http://n2t.net/addgene:13705 ; RRID:Addgene_13705)
  • For your References section:

    Association of the human papillomavirus type 16 E7 oncoprotein with the 600-kDa retinoblastoma protein-associated factor, p600. Huh KW, DeMasi J, Ogawa H, Nakatani Y, Howley PM, Munger K. Proc Natl Acad Sci U S A. 2005 Aug 9. 102(32):11492-7. 10.1073/pnas.0505337102 PubMed 16061792