pelB-MBP-P13-ss
(Plasmid
#137065)
-
PurposeE. coli expression clone (T7lac promoter) for mature P13 (aa 22-179) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepelB-MBP (DNASU access no. EvNO00813783)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAAC66426.1
-
Alt nameP13 BB0034
-
SpeciesBorrelia burgdorferi B31
-
Mutationmature P13: lacks the P13 signal peptide
-
Entrez GeneBB_0034 (a.k.a. BB_0034)
- Promoter T7lac
-
Tag
/ Fusion Protein
- PelB signal peptide + His10 + maltose binding protein + TEV protease cleavage
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAAAGGTGAAATCATGCCGAACATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid uses the T7lac promoter to express in E. coli the mature (lacking the signal peptide), wild-type protein containing an N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage site. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pelB-MBP-P13-ss was a gift from Debra Hansen (Addgene plasmid # 137065 ; http://n2t.net/addgene:137065 ; RRID:Addgene_137065) -
For your References section:
Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280