Skip to main content
Addgene

pFastbac-Dual-StrepII-BARD1
(Plasmid #137166)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137166 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastbac-Dual
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5237
  • Total vector size (bp) 7547
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BARD1
  • Alt name
    BRCA1 associated RING domain 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2334
  • Mutation
    fully synthetic, codon optimized for insect expression
  • Entrez Gene
    BARD1
  • Promoter p10
  • Tag / Fusion Protein
    • StrepII (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer GTATATTAATTAAAATACTATACTG
  • 3′ sequencing primer TTGTCTCCTTCCGTGTTTCA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Fully synthetic gene sequence, produced by Gene Universal
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For information about purifying BARD1 protein using this plasmid, please refer to Tan et al, 2020 PLoS One.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastbac-Dual-StrepII-BARD1 was a gift from Andrew Deans (Addgene plasmid # 137166 ; http://n2t.net/addgene:137166 ; RRID:Addgene_137166)
  • For your References section:

    Preparation and purification of mono-ubiquitinated proteins using Avi-tagged ubiquitin. Tan W, Murphy VJ, Charron A, van Twest S, Sharp M, Constantinou A, Parker MW, Crismani W, Bythell-Douglas R, Deans AJ. PLoS One. 2020 Feb 24;15(2):e0229000. doi: 10.1371/journal.pone.0229000. eCollection 2020. 10.1371/journal.pone.0229000 PubMed 32092106