pAIO-LbCpf1
(Plasmid
#137847)
-
PurposeLbCpf1 and gRNA expression plasmid for P. falciparum; no selection in parasites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAIO3
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLbCpf1-NLS-FLAG
-
Alt nameCpf1
-
SpeciesLachnospiraceae bacterium ND2006
-
Insert Size (bp)3765
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTAGAAAAGGAATAACTAATATTTTATTTATTATCATTCAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZetsche et al, Addgene #69988
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAIO-LbCpf1 was a gift from Josh Beck (Addgene plasmid # 137847 ; http://n2t.net/addgene:137847 ; RRID:Addgene_137847) -
For your References section:
EXP1 is required for organisation of EXP2 in the intraerythrocytic malaria parasite vacuole. Nessel T, Beck JM, Rayatpisheh S, Jami-Alahmadi Y, Wohlschlegel JA, Goldberg DE, Beck JR. Cell Microbiol. 2020 Jan 28:e13168. doi: 10.1111/cmi.13168. 10.1111/cmi.13168 PubMed 31990132