R26-EGFP HMEJ donor vector
(Plasmid
#137927)
-
PurposeROSA26 knock-in vector with homology-mediated end joining(HMEJ)-based method
-
Depositing Lab
-
Depositing OrganizationRIKEN Center for Biosystems Dynamics Research, Kobe
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 137927-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 137927-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBluescriptII SK+
- Backbone size w/o insert (bp) 2865
- Total vector size (bp) 5644
-
Vector typeMouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSA-EGFP-bpA with homology arms
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)2779
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer GTAATACGACTCACTATAGGGC
- 3′ sequencing primer AATTAACCCTCACTAAAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 137927-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 137927-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R26-EGFP HMEJ donor vector was a gift from Hiroshi Kiyonari (Addgene plasmid # 137927 ; http://n2t.net/addgene:137927 ; RRID:Addgene_137927) -
For your References section:
Pronuclear Microinjection during S-Phase Increases the Efficiency of CRISPR-Cas9-Assisted Knockin of Large DNA Donors in Mouse Zygotes. Abe T, Inoue KI, Furuta Y, Kiyonari H. Cell Rep. 2020 May 19;31(7):107653. doi: 10.1016/j.celrep.2020.107653. 10.1016/j.celrep.2020.107653 PubMed 32433962