R26-EGFP HMEJ donor vector
(Plasmid
#137927)
-
PurposeROSA26 knock-in vector with homology-mediated end joining(HMEJ)-based method
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescriptII SK+
- Backbone size w/o insert (bp) 2865
- Total vector size (bp) 5644
-
Vector typeMouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSA-EGFP-bpA with homology arms
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)2779
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer GTAATACGACTCACTATAGGGC
- 3′ sequencing primer AATTAACCCTCACTAAAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R26-EGFP HMEJ donor vector was a gift from Hiroshi Kiyonari (Addgene plasmid # 137927 ; http://n2t.net/addgene:137927 ; RRID:Addgene_137927) -
For your References section:
Pronuclear Microinjection during S-Phase Increases the Efficiency of CRISPR-Cas9-Assisted Knockin of Large DNA Donors in Mouse Zygotes. Abe T, Inoue KI, Furuta Y, Kiyonari H. Cell Rep. 2020 May 19;31(7):107653. doi: 10.1016/j.celrep.2020.107653. 10.1016/j.celrep.2020.107653 PubMed 32433962