Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

R26-EGFP HMEJ donor vector
(Plasmid #137927)


Item Catalog # Description Quantity Price (USD)
Plasmid 137927 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
    pBluescriptII SK+
  • Backbone size w/o insert (bp) 2865
  • Total vector size (bp) 5644
  • Vector type
    Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    SA-EGFP-bpA with homology arms
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer GTAATACGACTCACTATAGGGC
  • 3′ sequencing primer AATTAACCCTCACTAAAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    R26-EGFP HMEJ donor vector was a gift from Hiroshi Kiyonari (Addgene plasmid # 137927 ; ; RRID:Addgene_137927)
  • For your References section:

    Pronuclear Microinjection during S-Phase Increases the Efficiency of CRISPR-Cas9-Assisted Knockin of Large DNA Donors in Mouse Zygotes. Abe T, Inoue KI, Furuta Y, Kiyonari H. Cell Rep. 2020 May 19;31(7):107653. doi: 10.1016/j.celrep.2020.107653. 10.1016/j.celrep.2020.107653 PubMed 32433962