-
PurposepTet-CTRL encodes TetON and TetOFF transactivators. Can be transduced using Lentiviral particles
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCustom
- Backbone size w/o insert (bp) 7821
- Total vector size (bp) 9807
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetON-P2A-TetOFF-T2A-bsd
-
Insert Size (bp)1986
- Promoter EF1a core promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGAACGTTCTTTTTCGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBoth parts of the insert originate from plasmids from Addgene: "rtTA2S‐M2" TetON transactivator was cloned from Addgene #62346 (Hiroshi Ochiai) and "tTS" TetOFFtransactivator was cloned from Addgene #12390 (Zuoshang Xu).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid can be used in conjunction with pLenti-Tet (Addgene #138086) that has the ORF for the gene of interest of which expression can then be induced with Tetracycline or Doxycyline in Mammalian cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTet-CTRL was a gift from Eva Frickel (Addgene plasmid # 138085) -
For your References section:
Human GBP1 is a microbe-specific gatekeeper of macrophage apoptosis and pyroptosis. Fisch D, Bando H, Clough B, Hornung V, Yamamoto M, Shenoy AR, Frickel EM. EMBO J. 2019 Jul 1;38(13):e100926. doi: 10.15252/embj.2018100926. Epub 2019 Jun 3. 10.15252/embj.2018100926 PubMed 31268602