pTet-CTRL
(Plasmid #138085)

• Purpose: pTet-CTRL encodes TetON and TetOFF transactivators. Can be transduced using Lentiviral particles
• Depositing Lab: Eva Frickel
• Publication: Fisch et al EMBO J. 2019 Jul 1;38(13):e100926. doi: 10.15252/embj.2018100926. Epub 2019 Jun 3.

Backbone

• Vector backbone: Custom
• Backbone size w/o insert (bp): 7821
• Total vector size (bp): 9807
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TetON-P2A-TetOFF-T2A-bsd
• Insert Size (bp): 1986
• Promoter: EF1a core promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGAACGTTCTTTTTCGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Both parts of the insert originate from plasmids from Addgene: "rtTA2S‐M2" TetON transactivator was cloned from Addgene #62346 (Hiroshi Ochiai) and "tTS" TetOFFtransactivator was cloned from Addgene #12390 (Zuoshang Xu).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid can be used in conjunction with pLenti-Tet (Addgene #138086) that has the ORF for the gene of interest of which expression can then be induced with Tetracycline or Doxycyline in Mammalian cells.