Skip to main content
Addgene

TOP2A sgRNA2
(Plasmid #138191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138191 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 52961)
  • Total vector size (bp) 14873
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TOP2A
  • gRNA/shRNA sequence
    CACCGATGCTGCTATCAGCCTGGT
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    TOP2A (a.k.a. TOP2, TOP2alpha, TOPIIA, TP2A)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TOP2A sgRNA2 was a gift from Wen Xue (Addgene plasmid # 138191 ; http://n2t.net/addgene:138191 ; RRID:Addgene_138191)
  • For your References section:

    Depletion of TRRAP induces p53-independent senescence in liver cancer by downregulating mitotic genes. Kwan SY, Sheel A, Song CQ, Zhang XO, Jiang T, Dang H, Cao Y, Ozata DM, Mou H, Yin H, Weng Z, Wang XW, Xue W. Hepatology. 2019 Jun 12. doi: 10.1002/hep.30807. 10.1002/hep.30807 PubMed 31188495