pSB1C3-hsg(M)
(Plasmid
#138262)
-
PurposeSubcloning and expression of mCherry-targeting sgRNA M for use in Traffic Light reporter system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB1C3
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA M
-
gRNA/shRNA sequenceGTTGCTCACCATGGTGGCGAC
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1C3-hsg(M) was a gift from Xiao Wang (Addgene plasmid # 138262 ; http://n2t.net/addgene:138262 ; RRID:Addgene_138262) -
For your References section:
RNA-Guided Recombinase-Cas9 Fusion Targets Genomic DNA Deletion and Integration. Standage-Beier K, Brookhouser N, Balachandran P, Zhang Q, Brafman DA, Wang X. CRISPR J. 2019 Aug;2:209-222. doi: 10.1089/crispr.2019.0013. 10.1089/crispr.2019.0013 PubMed 31436506