lentiCRISPR v2-sgMyc_1
(Plasmid
#138324)
-
PurposeExpress guide RNA 2 for mouse Myc
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerZhang lab
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecMyc sgRNA
-
Alt namesgRNA targeting mouse Myc
-
gRNA/shRNA sequenceGTCAATGCACTCGGACGCGG
-
SpeciesSynthetic
-
Insert Size (bp)20
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgMyc_1 was a gift from Yi Zhang (Addgene plasmid # 138324 ; http://n2t.net/addgene:138324 ; RRID:Addgene_138324) -
For your References section:
Myc and Dnmt1 impede the pluripotent to totipotent state transition in embryonic stem cells. Fu X, Wu X, Djekidel MN, Zhang Y. Nat Cell Biol. 2019 Jul;21(7):835-844. doi: 10.1038/s41556-019-0343-0. Epub 2019 Jun 17. 10.1038/s41556-019-0343-0 PubMed 31209294