Skip to main content
Addgene
Open Menu

pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP
(Plasmid #138334)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138334 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 138334-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 138334-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pRP.Des2d
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    5'UTR-ApoB48-Linker-eGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7403
  • Entrez Gene
    APOB (a.k.a. FCHL2, FLDB, LDLCQ4, apoB-100, apoB-48)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CAAGTTTGTACAAAAAAGCAGGCT
  • 3′ sequencing primer AGCCTGCTTTTTTGTACAAACTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was produced for our laboratory by Cyagen Biosciences, Inc

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP was a gift from Mahmood Hussain (Addgene plasmid # 138334 ; http://n2t.net/addgene:138334 ; RRID:Addgene_138334)

  • For your References section:

    Model systems to study assembly, trafficking and secretion of apoB-lipoproteins using fluorescent fusion proteins. Walsh MT, Celestin OM, Thierer JH, Rajan S, Farber SA, Hussain MM. J Lipid Res. 2019 Dec 30. pii: jlr.RA119000259. doi: 10.1194/jlr.RA119000259. 10.1194/jlr.RA119000259 PubMed 31888978
Related items:
Commonly requested with: