-
PurposeExpresses APOB-Linker-eGFP
-
Depositing Lab
-
Depositing OrganizationSUNY Downstate Medical Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 138334-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 138334-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepRP.Des2d
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name5'UTR-ApoB48-Linker-eGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7403
-
Entrez GeneAPOB (a.k.a. FCHL2, FLDB, LDLCQ4, apoB-100, apoB-48)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CAAGTTTGTACAAAAAAGCAGGCT
- 3′ sequencing primer AGCCTGCTTTTTTGTACAAACTTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was produced for our laboratory by Cyagen Biosciences, Inc
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 138334-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 138334-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP was a gift from Mahmood Hussain (Addgene plasmid # 138334 ; http://n2t.net/addgene:138334 ; RRID:Addgene_138334) -
For your References section:
Model systems to study assembly, trafficking and secretion of apoB-lipoproteins using fluorescent fusion proteins. Walsh MT, Celestin OM, Thierer JH, Rajan S, Farber SA, Hussain MM. J Lipid Res. 2019 Dec 30. pii: jlr.RA119000259. doi: 10.1194/jlr.RA119000259. 10.1194/jlr.RA119000259 PubMed 31888978