pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP
(Plasmid
#138334)
-
PurposeExpresses APOB-Linker-eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRP.Des2d
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name5'UTR-ApoB48-Linker-eGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7403
-
Entrez GeneAPOB (a.k.a. FCHL2, FLDB, LDLCQ4, apoB-100, apoB-48)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CAAGTTTGTACAAAAAAGCAGGCT
- 3′ sequencing primer AGCCTGCTTTTTTGTACAAACTTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was produced for our laboratory by Cyagen Biosciences, Inc
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP was a gift from Mahmood Hussain (Addgene plasmid # 138334 ; http://n2t.net/addgene:138334 ; RRID:Addgene_138334) -
For your References section:
Model systems to study assembly, trafficking and secretion of apoB-lipoproteins using fluorescent fusion proteins. Walsh MT, Celestin OM, Thierer JH, Rajan S, Farber SA, Hussain MM. J Lipid Res. 2019 Dec 30. pii: jlr.RA119000259. doi: 10.1194/jlr.RA119000259. 10.1194/jlr.RA119000259 PubMed 31888978