pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP
(Plasmid #138334)

• Purpose: Expresses APOB-Linker-eGFP
• Depositing Lab: Mahmood Hussain
• Publication: Walsh et al J Lipid Res. 2019 Dec 30. pii: jlr.RA119000259. doi: 10.1194/jlr.RA119000259.

Backbone

• Vector backbone: pRP.Des2d
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 5'UTR-ApoB48-Linker-eGFP
• Species: H. sapiens (human)
• Insert Size (bp): 7403
• Entrez Gene: APOB (a.k.a. FCHL2, FLDB, LDLCQ4, apoB-100, apoB-48)
• Promoter: CMV
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: CAAGTTTGTACAAAAAAGCAGGCT
• 3′ sequencing primer: AGCCTGCTTTTTTGTACAAACTTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This plasmid was produced for our laboratory by Cyagen Biosciences, Inc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry