Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP
(Plasmid #138334)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138334 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    5'UTR-ApoB48-Linker-eGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7403
  • Entrez Gene
    APOB (a.k.a. FCHL2, FLDB, LDLCQ4, apoB-100, apoB-48)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CAAGTTTGTACAAAAAAGCAGGCT
  • 3′ sequencing primer AGCCTGCTTTTTTGTACAAACTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was produced for our laboratory by Cyagen Biosciences, Inc

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP was a gift from Mahmood Hussain (Addgene plasmid # 138334 ; http://n2t.net/addgene:138334 ; RRID:Addgene_138334)
  • For your References section:

    Model systems to study assembly, trafficking and secretion of apoB-lipoproteins using fluorescent fusion proteins. Walsh MT, Celestin OM, Thierer JH, Rajan S, Farber SA, Hussain MM. J Lipid Res. 2019 Dec 30. pii: jlr.RA119000259. doi: 10.1194/jlr.RA119000259. 10.1194/jlr.RA119000259 PubMed 31888978