-
Purpose2nd Generation Lentiviral vector. Expresses an N-terminal p300-dCas9 fusion protein and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlasmid may be prone to recombination. It is recommended to screen multiple DNA preps from individual colonies.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep300 core
-
Insert Size (bp)1851
- Promoter TRE3G
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer TTCTTCTGGCGGTTCTCTTCAGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR_TRE3G-p300-dCas9-P2A-mCherry was a gift from Jian Xu (Addgene plasmid # 138456) -
For your References section:
Interrogation of enhancer function by enhancer-targeting CRISPR epigenetic editing. Li K, Liu Y, Cao H, Zhang Y, Gu Z, Liu X, Yu A, Kaphle P, Dickerson KE, Ni M, Xu J. Nat Commun. 2020 Jan 24;11(1):485. doi: 10.1038/s41467-020-14362-5. 10.1038/s41467-020-14362-5 PubMed 31980609