Skip to main content

pHR_TRE3G-p300-dCas9-P2A-mCherry
(Plasmid #138456)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138456 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Plasmid may be prone to recombination. It is recommended to screen multiple DNA preps from individual colonies.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p300 core
  • Insert Size (bp)
    1851
  • Promoter TRE3G

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer N/A
  • 3′ sequencing primer TTCTTCTGGCGGTTCTCTTCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR_TRE3G-p300-dCas9-P2A-mCherry was a gift from Jian Xu (Addgene plasmid # 138456)
  • For your References section:

    Interrogation of enhancer function by enhancer-targeting CRISPR epigenetic editing. Li K, Liu Y, Cao H, Zhang Y, Gu Z, Liu X, Yu A, Kaphle P, Dickerson KE, Ni M, Xu J. Nat Commun. 2020 Jan 24;11(1):485. doi: 10.1038/s41467-020-14362-5. 10.1038/s41467-020-14362-5 PubMed 31980609