p6H-SUMO3-ORF24-NTD-Strep
(Plasmid
#138467)
-
PurposeExpresses SUMO3-tagged ORF24-NTD-Strep in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep6H-SUMO3
- Backbone size w/o insert (bp) 5599
- Total vector size (bp) 6195
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameORF24
-
SpeciesKSHV (HHV-8)
-
Insert Size (bp)600
-
MutationAmino acids 2-201
-
Entrez GeneORF24 (a.k.a. HHV8GK18_gp27)
- Promoter T7
-
Tags
/ Fusion Proteins
- SUMO3 (N terminal on backbone)
- Strep-Tag II (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6H-SUMO3-ORF24-NTD-Strep was a gift from Britt Glaunsinger (Addgene plasmid # 138467 ; http://n2t.net/addgene:138467 ; RRID:Addgene_138467) -
For your References section:
The gammaherpesviral TATA-box-binding protein directly interacts with the CTD of host RNA Pol II to direct late gene transcription. Castaneda AF, Didychuk AL, Louder RK, McCollum CO, Davis ZH, Nogales E, Glaunsinger BA. PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep. 10.1371/journal.ppat.1008843 PubMed 32886723