pGEX4T1-Rpb4/7
(Plasmid
#138484)
-
PurposeExpresses GST-tagged Rpb4 and His-tagged Rpb7 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-4T-1
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4946
- Total vector size (bp) 5941
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameRpb4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)429
-
Entrez GenePOLR2D (a.k.a. HSRBP4, HSRPB4, RBP4, RPB16, RPB4)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRpb7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)516
-
Entrez GenePOLR2G (a.k.a. RPB19, RPB7, hRPB19, hsRPB7)
- Promoter tac
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T1-Rpb4/7 was a gift from Britt Glaunsinger (Addgene plasmid # 138484 ; http://n2t.net/addgene:138484 ; RRID:Addgene_138484) -
For your References section:
The gammaherpesviral TATA-box-binding protein directly interacts with the CTD of host RNA Pol II to direct late gene transcription. Castaneda AF, Didychuk AL, Louder RK, McCollum CO, Davis ZH, Nogales E, Glaunsinger BA. PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep. 10.1371/journal.ppat.1008843 PubMed 32886723