Skip to main content

SpCas9-NG
(Plasmid #138566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUGW
  • Total vector size (bp) 12859
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9-NG
  • Species
    Synthetic
  • Insert Size (bp)
    4641
  • Mutation
    L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R
  • Promoter EFS
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • FLAG (C terminal on insert)
    • BSD (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5' - ggtcttgaaaggagtgggaattgg - 3'
  • 3′ sequencing primer 5' - CAGGTCGCTTGTCGCCTCC - 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SpCas9-NG was a gift from Hyongbum Kim (Addgene plasmid # 138566 ; http://n2t.net/addgene:138566 ; RRID:Addgene_138566)
  • For your References section:

    Prediction of the sequence-specific cleavage activity of Cas9 variants. Kim N, Kim HK, Lee S, Seo JH, Choi JW, Park J, Min S, Yoon S, Cho SR, Kim HH. Nat Biotechnol. 2020 Nov;38(11):1328-1336. doi: 10.1038/s41587-020-0537-9. Epub 2020 Jun 8. 10.1038/s41587-020-0537-9 PubMed 32514125