pAMS366-4xCDRE-GFP
(Plasmid #138657)

• Purpose: stable GFP reporter to monitor calcineurin activity via calcineurin-dependent response element (CDRE) in S. cerevisiae
• Depositing Lab: Sabrina Büttner
• Publication: Diessl et al Microbial Cell, 2020: in press

Backbone

• Vector backbone: pAMS366
• Total vector size (bp): 8962
• Vector type: yeast reporter plasmid
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 4xCDRE-CYC1(PM)-yeGFP
• Species: S. cerevisiae (budding yeast); A. victoria
• Promoter: CYC1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: GTG GGT TTA GAT GAC AAG GGA GAC G
• 3′ sequencing primer: CGT ACT GTG AGC CAG AGT TG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: 1. Stathopoulos AM, and Cyert MS (1997). Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 11(24): 3432–3444. 9407035. and 2. Janke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, and Knop M (2004). A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast. 21(11): 947–962. doi: 10.1002/yea.1142.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg

For construction of pAMS366-4xCDRE-GFP, we used yeGFP from pYM25 (Janke
et al. 2004, sequence available from euroscarf), sequencing showed a
644C>G (Thr>Arg) mutation."