Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #138658)


Item Catalog # Description Quantity Price (USD)
Plasmid 138658 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 11281
  • Vector type
    yeast reporter plasmid
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    S. cerevisiae (budding yeast), Synthetic; A. victoria
  • Promoter CYC1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    1. Stathopoulos AM, and Cyert MS (1997). Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 11(24): 3432–3444. 9407035. and 2. Mateus C, and Avery SV (2000). Destabilized green fluorescent protein for monitoring dynamic changes in yeast gene expression with flow cytometry. Yeast. 16(14): 1313–1323. doi: 10.1002/1097-0061(200010)16:14<1313::AID-YEA626>3.0.CO;2-O.
  • Article Citing this Plasmid

Terms and Licenses

Depositor Comments

1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg

For construction of pAMS366-4xCDRE-GFP-PEST, we used yEGFP3-PEST from
Mateus & Avery 2000 (original yEGFP3 from Cormack et al. 1997),
sequencing showed a 216T>G silent mutation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAMS366-4xCDRE-GFP-PEST was a gift from Sabrina Büttner (Addgene plasmid # 138658 ; ; RRID:Addgene_138658)
  • For your References section:

    Stable and destabilized GFP reporters to monitor calcineurin activity in Saccharomyces cerevisiae. Diessl , J., Nandy, A., Schug, C., Habernig, L., and Büttner, S.. Microbial Cell, 2020: in press