pcDNA3.1-Hyg-RFPKDEL
(Plasmid
#138660)
-
PurposeReporter plasmid expressing the ER-located RFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1-Hyg
-
Backbone manufacturerThermofisher
- Backbone size w/o insert (bp) 5570
- Total vector size (bp) 6362
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRFP-KDEL
-
Alt nameRed fluorescent protein ER-located
-
SpeciesSynthetic
-
Insert Size (bp)792
- Promoter CMV
-
Tag
/ Fusion Protein
- KDEL (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional References:
Chaumont L, Jouneau L, Huetz F, van Muilekom DR, Peruzzi M, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. Unexpected regulatory functions of cyprinid Viperin on inflammation and metabolism. BMC Genomics. 2024 Jun 29;25(1):650. doi: 10.1186/s12864-024-10566-x. PMID: 38951796; PMCID: PMC11218377.
Chaumont, L., Peruzzi, M., Huetz, F., Raffy, C., Le Hir, J., Minke, J., Boudinot, P., Collet, B., 2024. Salmonid Double-stranded RNA–Dependent Protein Kinase Activates Apoptosis and Inhibits Protein Synthesis. J. Immunol. https://doi.org/10.4049/JIMMUNOL.2400076 PMID: 39058317
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Hyg-RFPKDEL was a gift from Bertrand Collet (Addgene plasmid # 138660 ; http://n2t.net/addgene:138660 ; RRID:Addgene_138660) -
For your References section:
Viral Resistance and IFN Signaling in STAT2 Knockout Fish Cells. Dehler CE, Lester K, Della Pelle G, Jouneau L, Houel A, Collins C, Dovgan T, Machat R, Zou J, Boudinot P, Martin SAM, Collet B. J Immunol. 2019 Jul 15;203(2):465-475. doi: 10.4049/jimmunol.1801376. Epub 2019 May 29. 10.4049/jimmunol.1801376 PubMed 31142600