-
PurposeHA-PEROXO Lentiviral Construct. Expresses a Peroxisomal Tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLJC5
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3XHA-EGFP-PEX26
- Promoter UBC
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcorI (not destroyed)
- 5′ sequencing primer TGAAGCTCCGGTTTTGAACT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC5-3XHA-EGFP-PEX26 was a gift from David Sabatini (Addgene plasmid # 139054 ; http://n2t.net/addgene:139054 ; RRID:Addgene_139054) -
For your References section:
A PEROXO-Tag Enables Rapid Isolation of Peroxisomes from Human Cells. Ray GJ, Boydston EA, Shortt E, Wyant GA, Lourido S, Chen WW, Sabatini DM. iScience. 2020 May 22;23(5):101109. doi: 10.1016/j.isci.2020.101109. Epub 2020 Apr 28. 10.1016/j.isci.2020.101109 PubMed 32417403