Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLJC5-LAMP1-RFP-3xHA
(Plasmid #102932)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102932 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LAMP1
  • Species
    R. norvegicus (rat)
  • Promoter ubc
  • Tag / Fusion Protein
    • RFP-HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcorI (not destroyed)
  • 5′ sequencing primer CGAAGGAATAGAAGAAGAAGGTGGAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

LAMP1-RFP was cloned from Plasmid #34611

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJC5-LAMP1-RFP-3xHA was a gift from David Sabatini (Addgene plasmid # 102932 ; http://n2t.net/addgene:102932 ; RRID:Addgene_102932)
  • For your References section:

    Lysosomal metabolomics reveals V-ATPase- and mTOR-dependent regulation of amino acid efflux from lysosomes. Abu-Remaileh M, Wyant GA, Kim C, Laqtom NN, Abbasi M, Chan SH, Freinkman E, Sabatini DM. Science. 2017 Nov 10;358(6364):807-813. doi: 10.1126/science.aan6298. Epub 2017 Oct 26. 10.1126/science.aan6298 PubMed 29074583