pL90-Nat-2xHO
(Plasmid
#139069)
-
PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepL59-Nat
-
Backbone manufacturerAddgene plasmid # 140465, based on backbone made by Jean-Marc Daran (Addgene plasmid # 101165)
- Total vector size (bp) 10002
-
Modifications to backboneInsertion of two guide RNAs targeting the HO locus
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPlasmid yield is 1-5 ug in a miniprep
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTwo guide RNAs targeting the HO endonuclease
-
Insert Size (bp)432
- Promoter TDH3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTAGGTATTGATTGTAATTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Experiments were performed with 2 hours recovery in YPD. Plasmid is loss performed with growth in rich medium and confirmed with loss of Nourseothricin resistance.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL90-Nat-2xHO was a gift from Gianni Liti (Addgene plasmid # 139069 ; http://n2t.net/addgene:139069 ; RRID:Addgene_139069) -
For your References section:
Intragenic repeat expansion in the cell wall protein gene HPF1 controls yeast chronological aging. Barre B, Hallin J, Yue JX, Persson K, Mikhalev E, Irizar A, Holt S, Thompson D, Molin M, Warringer J, Liti G. Genome Res. 2020 Apr 10. pii: gr.253351.119. doi: 10.1101/gr.253351.119. 10.1101/gr.253351.119 PubMed 32277013