Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PCR4-Hsp68::lacZ-H11
(Plasmid #139099)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139099 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PCR4-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 3956
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR
  • Promoter Hsp68

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCCTTCAGCTGCCCACTCTAC
  • 3′ sequencing primer ccaggaacatccaaactga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCR4-Hsp68::lacZ-H11 was a gift from Len Pennacchio (Addgene plasmid # 139099 ; http://n2t.net/addgene:139099 ; RRID:Addgene_139099)
  • For your References section:

    Comprehensive In Vivo Interrogation Reveals Phenotypic Impact of Human Enhancer Variants. Kvon EZ, Zhu Y, Kelman G, Novak CS, Plajzer-Frick I, Kato M, Garvin TH, Pham Q, Harrington AN, Hunter RD, Godoy J, Meky EM, Akiyama JA, Afzal V, Tran S, Escande F, Gilbert-Dussardier B, Jean-Marcais N, Hudaiberdiev S, Ovcharenko I, Dobbs MB, Gurnett CA, Manouvrier-Hanu S, Petit F, Visel A, Dickel DE, Pennacchio LA. Cell. 2020 Mar 6. pii: S0092-8674(20)30208-7. doi: 10.1016/j.cell.2020.02.031. 10.1016/j.cell.2020.02.031 PubMed 32169219