-
Purpose(Empty Backbone) enSERT LacZ reporter vector for site-specific integration into the H11 locus (contains Shh minimal promoter)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePCR4-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 3956
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
- Promoter Shh
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCTTCAGCTGCCCACTCTAC
- 3′ sequencing primer ccaggaacatccaaactga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are minor differences between the Addgene verified result and the depositor's reference sequence (under the supplemental documents section). Please refer to the Addgene NGS result for more accurate sequence information. These differences do not affect the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCR4-Shh::lacZ-H11 was a gift from Len Pennacchio (Addgene plasmid # 139098 ; http://n2t.net/addgene:139098 ; RRID:Addgene_139098) -
For your References section:
Comprehensive In Vivo Interrogation Reveals Phenotypic Impact of Human Enhancer Variants. Kvon EZ, Zhu Y, Kelman G, Novak CS, Plajzer-Frick I, Kato M, Garvin TH, Pham Q, Harrington AN, Hunter RD, Godoy J, Meky EM, Akiyama JA, Afzal V, Tran S, Escande F, Gilbert-Dussardier B, Jean-Marcais N, Hudaiberdiev S, Ovcharenko I, Dobbs MB, Gurnett CA, Manouvrier-Hanu S, Petit F, Visel A, Dickel DE, Pennacchio LA. Cell. 2020 Mar 6. pii: S0092-8674(20)30208-7. doi: 10.1016/j.cell.2020.02.031. 10.1016/j.cell.2020.02.031 PubMed 32169219