Skip to main content

pCMV-ACBEmax
(Plasmid #139106)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139106 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bi_partite_NLS-TadA*-XTEN_linker-TadA-XTEN_linker-SpCas9(D10A)-SH3_linker-rAPOBEC1-2xUGI-SV40NLS
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    6903
  • Promoter CMV promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CTGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-ACBEmax was a gift from Nozomu Yachie (Addgene plasmid # 139106 ; http://n2t.net/addgene:139106 ; RRID:Addgene_139106)
  • For your References section:

    Base editors for simultaneous introduction of C-to-T and A-to-G mutations. Sakata RC, Ishiguro S, Mori H, Tanaka M, Tatsuno K, Ueda H, Yamamoto S, Seki M, Masuyama N, Nishida K, Nishimasu H, Arakawa K, Kondo A, Nureki O, Tomita M, Aburatani H, Yachie N. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0509-0. doi: 10.1038/s41587-020-0509-0. 10.1038/s41587-020-0509-0 PubMed 32483365