pCMV-Target-AIDmax
(Plasmid
#139107)
-
PurposeMammalian Target-AIDmax expression vector (pSI-626)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBi_partite_NLS-SpCas9(D10A)-SH3_linker-PmCDA1-UGI-SV40NLS
-
SpeciesSynthetic
-
Insert Size (bp)5346
- Promoter CMV promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer CTGGCAACTAGAAGGCACAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Target-AIDmax was a gift from Nozomu Yachie (Addgene plasmid # 139107 ; http://n2t.net/addgene:139107 ; RRID:Addgene_139107) -
For your References section:
Base editors for simultaneous introduction of C-to-T and A-to-G mutations. Sakata RC, Ishiguro S, Mori H, Tanaka M, Tatsuno K, Ueda H, Yamamoto S, Seki M, Masuyama N, Nishida K, Nishimasu H, Arakawa K, Kondo A, Nureki O, Tomita M, Aburatani H, Yachie N. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0509-0. doi: 10.1038/s41587-020-0509-0. 10.1038/s41587-020-0509-0 PubMed 32483365