pSB-Bleo STAT3
(Plasmid
#139184)
-
Purpose(Empty Backbone) Empty backbone encoding constitutive bleomycin resistance with an inducible STAT3 promoter to allow for an insert in a Sleeping Beauty backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
- Backbone size (bp) 4643
-
Vector typeMammalian Expression ; Transposon
- Promoter STAT3
-
Selectable markersBleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agctcgtttagtgaaccgtcagatc
- 3′ sequencing primer gatgagtttggacaaaccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Empty SB-transposon with STAT3 inducible promoter and constitutive bleomycin resistance.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-Bleo STAT3 was a gift from Neal Devaraj (Addgene plasmid # 139184 ; http://n2t.net/addgene:139184 ; RRID:Addgene_139184)