-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 13919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3 promoter
-
Backbone manufacturerpromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAS 3'UTR
-
SpeciesH. sapiens (human)
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (unknown if destroyed)
- 3′ cloning site Xba1 (unknown if destroyed)
- 5′ sequencing primer AAGGGCGGAAAGATCGCCGTG
- 3′ sequencing primer AATGTATCTTATCATGTCTGCTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-KRAS was a gift from Frank Slack (Addgene plasmid # 13919 ; http://n2t.net/addgene:13919 ; RRID:Addgene_13919) -
For your References section:
RAS is regulated by the let-7 microRNA family. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. Cell. 2005 Mar 11. 120(5):635-47. 10.1016/j.cell.2005.01.014 PubMed 15766527