Skip to main content
Addgene

pGL3-KRAS
(Plasmid #13919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13919 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3 promoter
  • Backbone manufacturer
    promega
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAS 3'UTR
  • Species
    H. sapiens (human)
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer AAGGGCGGAAAGATCGCCGTG
  • 3′ sequencing primer AATGTATCTTATCATGTCTGCTCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-KRAS was a gift from Frank Slack (Addgene plasmid # 13919 ; http://n2t.net/addgene:13919 ; RRID:Addgene_13919)
  • For your References section:

    RAS is regulated by the let-7 microRNA family. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. Cell. 2005 Mar 11. 120(5):635-47. 10.1016/j.cell.2005.01.014 PubMed 15766527