Skip to main content

pFRT-TO-RPB1-His WT CRres si2,4R
(Plasmid #139404)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139404 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFRT-TO
  • Backbone size w/o insert (bp) 5135
  • Total vector size (bp) 11071
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5937
  • GenBank ID
    NM_000937.5
  • Entrez Gene
    POLR2A (a.k.a. NEDHIB, POLR2, POLRA, RPB1, RPBh1, RPO2, RPOL2, RpIILS, hRPB220, hsRPB1)
  • Promoter pCMV, TRex
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFRT-TO-RPB1-His WT CRres si2,4R was a gift from Jesper Svejstrup (Addgene plasmid # 139404 ; http://n2t.net/addgene:139404 ; RRID:Addgene_139404)
  • For your References section:

    Regulation of the RNAPII Pool Is Integral to the DNA Damage Response. Tufegdzic Vidakovic A, Mitter R, Kelly GP, Neumann M, Harreman M, Rodriguez-Martinez M, Herlihy A, Weems JC, Boeing S, Encheva V, Gaul L, Milligan L, Tollervey D, Conaway RC, Conaway JW, Snijders AP, Stewart A, Svejstrup JQ. Cell. 2020 Mar 5. pii: S0092-8674(20)30153-7. doi: 10.1016/j.cell.2020.02.009. 10.1016/j.cell.2020.02.009 PubMed 32142654