Skip to main content
Addgene
Open Menu

pCAGGS-synPCB2.0
(Plasmid #139477)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139477 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 139477-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 139477-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    Junichi Miyazaki (Osaka University, Japan)
  • Backbone size w/o insert (bp) 4870
  • Total vector size (bp) 7891
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Fnr-Fd-T7
  • Alt name
    synPCB2.0
  • Species
    Synthetic; Thermosynechococcus elongatus bp-1
  • Insert Size (bp)
    3171
  • Mutation
    V413L
  • Promoter CAG promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer agatgctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutation V413L has no effect on the function of HO1.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-synPCB2.0 was a gift from Kazuhiro Aoki (Addgene plasmid # 139477 ; http://n2t.net/addgene:139477 ; RRID:Addgene_139477)

  • For your References section:

    Improvement of Phycocyanobilin Synthesis for Genetically Encoded Phytochrome-Based Optogenetics. Uda Y, Miura H, Goto Y, Yamamoto K, Mii Y, Kondo Y, Takada S, Aoki K. ACS Chem Biol. 2020 Nov 20;15(11):2896-2906. doi: 10.1021/acschembio.0c00477. Epub 2020 Nov 9. 10.1021/acschembio.0c00477 PubMed 33164485
Related items:
Commonly requested with: