-
PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 7338
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA and HaloTag donor
-
gRNA/shRNA sequenceAATCAGAGTCTCTCTCGGGC
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note Addgene NGS found some discrepancies in the ITR regions of these plasmids. These regions are repetitive and can be difficult to sequence using NGS. Depositor confirms plasmids are functional
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV ORANGE Dlg4-HaloTag KI was a gift from Harold MacGillavry (Addgene plasmid # 139656 ; http://n2t.net/addgene:139656 ; RRID:Addgene_139656) -
For your References section:
ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons. Willems J, de Jong APH, Scheefhals N, Mertens E, Catsburg LAE, Poorthuis RB, de Winter F, Verhaagen J, Meye FJ, MacGillavry HD. PLoS Biol. 2020 Apr 10;18(4):e3000665. doi: 10.1371/journal.pbio.3000665. 10.1371/journal.pbio.3000665 PubMed 32275651