Skip to main content

pTFPhiC31
(Plasmid #139671)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139671 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTF101
  • Backbone size w/o insert (bp) 9189
  • Total vector size (bp) 13601
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    phiC31 Integrase
  • Species
    bacteriophage P1
  • Insert Size (bp)
    2448
  • Promoter Maize Ubiquitin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGCTCACCCTGTTGTTTGGTGT
  • 3′ sequencing primer cgtatgttgtgtggaattgtgag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTFPhiC31 was a gift from James Birchler (Addgene plasmid # 139671 ; http://n2t.net/addgene:139671 ; RRID:Addgene_139671)
  • For your References section:

    Site-specific recombinase genome engineering toolkit in maize. Cody JP, Graham ND, Zhao C, Swyers NC, Birchler JA. Plant Direct. 2020 Mar 9;4(3):e00209. doi: 10.1002/pld3.209. eCollection 2020 Mar. 10.1002/pld3.209 PubMed 32166212